Dna sequence shows a gene encoding a smallpolypeptide

The following DNA sequence shows a “gene” encoding a smallpolypeptide. The start codon is AUG and the three “stop” codons are UAA, UAG, and UGA. The promoter region of the DNA is inparetntheses.

5′ (ATGACGTATAA) TGACCGTACATGAGTAATACATAAATCAG 3′
3′ (TACTGCATATT) ACTGGCATGTACTCATTATGTATTTAGTC 5′

using the mRNA codon chart, transcribe and translate the”gene” from above.

a) which DNA strand did you choose as the template strand? Topor bottom? Why?

b) mRNA sequence (not including promoter region)=

c) mRNA sequence from start to stop codon=

d) anticodons for each codon=

e) amino acid sequence (including start amino)=

"Is this question part of your assignment? We can help"

ORDER NOW